Table 1
Primers used for molecular analysis of the BCL-2 and BAX genes
| Forward sequence (5′−3′) | Reverse sequence (5′−3′) | Product | Ta (°C) | MgCl2 | |
|---|---|---|---|---|---|
| Ta, annealing temperature for each primer set. | |||||
| *All BCL-2 primers were laboratory designed for amplification and sequencing of the BCL-2 gene in paraffin wax embedded samples except for the second reverse primer (P2), which was published previously15; †Primers for amplification and sequencing of BAX were published previously,16 except for the laboratory designed primers for exon 1 of BAX. | |||||
| BCL-2 | |||||
| Exon 1 P1 | cctcgtccaagaatgcaa | gctgggaggagaagat | 291 bp | 56°C | 2.0mM |
| P2 | cgcaccgggcatcttctcctcccagc | gagagctcctccaccaccg* | 284 bp | 55°C | 0.5mM |
| P3 | cccggcgacgacttct | agagcccacccgcactc | 367 bp | 61.7°C | 1.2mM |
| Exon 2 P4 | cgtggggtggcattctc | gggcaggcatgttgac | 224 bp | 54°C | 1.0mM |
| BAX | |||||
| Exon 1 | cggagcggcggtgat† | aagccccaggccggtag† | 131 bp | 64°C | 1.5mM |
| Exon 2/3 | accctagaacccaagagtc | gctgagagtcctgtgtcc | 400 bp | 58°C | 1.5mM |
| Exon 3 (G8) tract | atccaggatcgagcagggcg | atcgctcagcttcttggtg | 94 bp | 58°C | 1.5mM |
| Exon 4 | tctcctgcaggatgattgc | tcccaggtcctcacagat | 209 bp | 58°C | 1.5mM |
| Exon 5 | caggcagtggggacaaggtt | gggtggtgggggtgaggag | 129 bp | 60°C | 1.5mM |
| Exon 6 | cccctggccgagtcactgaa | agcccatgtcccccaatc | 237 bp | 60°C | 1.5mM |
