rss
J Clin Pathol 58:1091-1095 doi:10.1136/jcp.2005.026013
  • Original article

STRAD in Peutz-Jeghers syndrome and sporadic cancers

Table 1

 Primer sequences and polymerase chain reaction conditions for sequencing of 13 exons and exon–intron boundaries of STRAD

Exon Forward primer Reverse primer Tm (°C) MgCl2 (mM)
1 ggtctggcggcggcgcggcagtaaaac cagtccctcctggctctgccaccgattccatctcc 65 1.25
2 ataggtgaagtccagtgctttgaatgg ctgaaaagcagtgtattttggca 52 1.25
3 gtctaaaggctgatagctaatttgttgcggc caatctatagcaattggcaattctaagggcaagtgtaacc 65 2.5
4 ttgctgttctgaatgtgggtgtgtcttctg ggctgttgcatggagatgacttcttgtggaagtttgtgtg 52 1.25
5 cctcgtgggtctgaattaccaccttcacccca ccaggggctgctgcagctttctcagcag 65 1.25
6 ccttttgttgttcttgtccttgcgtatggc gagtgtgtcacatggagggaggg 65 1.25
7+8 gctgccatctttgtgttgagcggc ggcggcctttcccatgattacag 65 1.25
9 gccaggtggagtgtgtgaagacca gggagccttcaggcattgcc 65 1.25
10 ctctctttagttctaccc gagtagctctcacactcagg 52 2.5
11 ccgctacagcccaggtcc cttcgggagagcagagggtg 65 2.5
12+13 ggctgaggcataagtggcagga ggatgcagaggccacccagag 65 1.25

This Article

Latest from JCP Education

Latest from JCP Education

Register for free content


Free sample
This recent issue is free to all users to allow everyone the opportunity to see the full scope and typical content of JCP.
View free sample issue >>

Don't forget to sign up for content alerts so you keep up to date with all the articles as they are published.

Latest Pathology jobs

Latest Pathology jobs