Sequences of primers used in our study
| Primer sets | Design | Nucleotide sequence (5′ to 3′) | Product |
|---|---|---|---|
| 1 | Intron between exon 3 and 4 of β catenin gene | Sense: TGATTTGATGGAGTTGGACATAntisense: CATTGCATACTGTCCATCAAT | DNA, 450 bpcDNA, 250 bp |
| 2 | Intron between exon 4 and 5 of β actin gene | Sense: AAATCGTGCGTGACATTAAGGAntisense: ATGATGGAGTTGAAGGTAGTT | DNA, 324 bpcDNA, 230 bp |









