rss
J Clin Pathol 57:766-768 doi:10.1136/jcp.2003.007880
  • Short report

An optimised protocol for the extraction of non-viral mRNA from human plasma frozen for three years

Table 1

 Sequences of primers used in our study

Primer sets Design Nucleotide sequence (5′ to 3′) Product
1 Intron between exon 3 and 4 of β catenin gene Sense: TGATTTGATGGAGTTGGACATAntisense: CATTGCATACTGTCCATCAAT DNA, 450 bpcDNA, 250 bp
2 Intron between exon 4 and 5 of β actin gene Sense: AAATCGTGCGTGACATTAAGGAntisense: ATGATGGAGTTGAAGGTAGTT DNA, 324 bpcDNA, 230 bp

This Article

Latest from JCP Education

Latest from JCP Education

Register for free content


Free sample
This recent issue is free to all users to allow everyone the opportunity to see the full scope and typical content of JCP.
View free sample issue >>

Don't forget to sign up for content alerts so you keep up to date with all the articles as they are published.

Latest Pathology jobs

Latest Pathology jobs