rss
J Clin Pathol 54:103-106 doi:10.1136/jcp.54.2.103

Detection of herpesvirus DNA by the polymerase chain reaction (PCR) in vitreous samples from patients with necrotising retinitis

Table 2

Primers and polymerase chain reaction (PCR) conditions

Primers Sequences Genes Size of anplified DNA MgCl2 concentration PCR conditions
HCMV, human cytomegalovirus; HSV, herpes simplex virus; VZV, varicella zoster virus.
HSV-1TK TkR`-5′tcagttagcctcccccatc Thymidine kinase 1130 bp 1 mM 95°C 1 min, 55°C 1 min, 72°C 1 min (35 cycles), and 72°C 15 min
TkF`-5′atggcttcgtacccctgcc
VZV-TK TkR`-5′aggaagtgttgtcctgaacggc Thymidine kinase 1024 bp 2 mM 95°C 1 min, 57°C 1 min, 72°C 1 min (35 cycles), and 72°C 15 min
TkF`-5′atgtcaacggataaaaccgatgt
HCMV PolF-5′gctatgtttcagatgtcgccgcc DNA polymerase 170 bp 1.5 mM 95°C 1 min, 62°C 1 min, 72°C 1 min (35 cycles), and 72°C 15 min
DNApol PolR-5′cccacctcgggctc aaacac

This Article

Latest from JCP Education

Latest from JCP Education

Register for free content


Free sample
This recent issue is free to all users to allow everyone the opportunity to see the full scope and typical content of JCP.
View free sample issue >>

Don't forget to sign up for content alerts so you keep up to date with all the articles as they are published.

  • Latest Pathology jobs

    Latest Pathology jobs